Review



paav cag mneongreen 565  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    Addgene inc paav cag mneongreen 565
    Paav Cag Mneongreen 565, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 19 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mneongreen/pAAV-CAG-mNeonGreen+(Plasmid+%2399134)/10__1016_slash_j__isci__2026__115554-284-21-23
    Average 93 stars, based on 19 article reviews
    paav cag mneongreen 565 - by Bioz Stars, 2026-09
    93/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: Engineered Membrane Vesicle Production via oprF or oprI Deletion Has Distinct Phenotypic Effects in Pseudomonas putida
    Article Snippet: .. This study Addgene Plasmid #182390 pRSFDuet-1 based plasmid containing VNpmNeonGreen_OmpAmCherry pRSFDuet-1_VNp-mNeonGreen_OmpAmCherry was a gift from Dan Mulvihill (Addgene plasmid # 182390 ; http://n2t.net/addgene:182390 ; RRID:Addgene_182390) (13) Addgene Plasmid #182388 pRSFDuet-1 based plasmid containing VNp6mNeonGreen pRSFDuet-1_VNp6-mNeonGreen was a gift from Dan Mulvihill (Addgene plasmid # 182388 ; http://n2t.net/addgene:182388 ; RRID:Addgene_182388) (13) pRW075 pBTL-2-based plasmid for the expression of spycatcher003The expression cassette included Plac, ribosome binding site [RBS; translation initiation rate (TIR) = 10277.53], ompAEC, linker, spycatcher003, RBS (TIR: This study 10 ompAEC:spytag003mNeonGreen 193180.16), mNeonGreen (originally from Addgene Plasmid #182388), linker, spytag003, and soxR terminator. .. The ompAEC, linkers, spycatcher003, and spytag003 were codon optimized using Integrated DNA Technologies Codon Optimization Tool.

    Article Title: Microinjection, gene knockdown, and CRISPR-mediated gene knock-in in the hard coral, Astrangia poculata
    Article Snippet: .. The oligo sequences were as follows ( Apoc homology sequences, sgRNA mutations , [linker], mNeon priming region ): Apoc_Mcol3_Homology_F: 5′GCGTCTCGTCCTGCCCGACCCAGTGCTGCTCCGG G AG G AA A [GCCGCA] ATGGTGAGCAAGGGC 3′ Apoc_Mcol3_Homology_R: 5′TAATTTCTAAATCTCGTGCTAATGTCGACGCATCA AGTGC T C GT G GC TTACTTGTACAGCTCGTC 3′ PCR amplification of the repair template was performed using 50 ng of plasmid containing mNeonGreen (Addgene 125134) as template in a touchdown PCR reaction (annealing temperature decreased 1 °C from 65 °C to 50 °C for the first 15 cycles followed by 20 cycles with an annealing temperature of 50 °C; extension time was 30 s). .. Afterwards, the template was digested by addition of DpnI enzyme (NEB R0176S) and incubation at 37 °C for 2 h. The repair template was then purified using a QiaQuick PCR purification kit (Qiagen 28704 prior to injection and quality assessed using agarose gel electrophoresis, to ensure size, and Nanodrop, to assess purity and concentration.

    Article Title: Engineered Membrane Vesicle Production via oprF or oprI Deletion Has Distinct Phenotypic Effects in Pseudomonas putida
    Article Snippet: Plasmid was sequenced verified by Oxford Nanopore Sequencing. .. This study pTM007 pBTL-2-based plasmid for the expression of mNeonGreen The expression cassette contained the Plac, RBS (TIR: 193180.16), and mNeonGreen (originally from Addgene Plasmid #182388). ..

    Article Title: A single valine to leucine switch disrupts Plasmodium falciparum AP2-G DNA binding and reveals GDV1’s role in ap2-g activation
    Article Snippet: .. Plasmid with tdTomato (pGEMT-PT2A-iRFP670-Tdtomato-GFP: Addgene plasmid # 111817) or mScarlet (pmScarlet_C1: Addgene plasmid # 85042) or mNeonGreen (ER-mNeonGreen: Addgene plasmid # 137804) or NanoLuciferease (pUAS-NanoLuc: Addgene plasmid # 87696) were obtained from Addgene Inc (USA). ..

    Article Title: PBK/TOPK mediates Ikaros, Aiolos and CTCF displacement from mitotic chromosomes and alters chromatin accessibility at selected C2H2-zinc finger protein binding sites
    Article Snippet: .. EBFP2 gene (3519 bp) atcctggttcctgttcttccccgagTAAGCTTGGGCCGCTCGAG gggataaggtgccatctttcccaggTTCCTGCCCGACCTTGGTAC Plasmid gifted by Stefan Stricker129 Ikzf1 left homology arm (820 bp to final codon) CCTGGGAAAGATGGCACC GCTCAGGTGGTAACGATG Genomic DNA Spacer (underlined) plus mNeonGreen (720 bp) gggggagcatcgttaccacctgagcggaggtggttctGTGAGCAAGGGCGAGGAG gtgcttcagtggggcctggctgggtTTACTTGTACAGCTCGTCCATG 3xnls-mNeonGreen (Addgene #98875), gift from Dorus Gadella130 Ikzf1 right homology arm (880 bp downstream) ACCCAGCCAGGCCCCACTG CTCGGGGAAGAACAGGAACCAGG Genomic DNA Verification of CRISPR/Cas9 engineered cells Purpose Oligo sequences Expected sizes Ikzf1 WT versus mNeonGreen KI (1) GGCTTTCGGGATCCCTTTGA TCCACTCCCAACATTGTCCG WT=197 bp KI=914 bp (for sanger sequencing) Ikzf1 WT versus mNeonGreen KI (2) CCTGGGAAAGATGGCACC CTCGGGGAAGAACAGGAACCAGG WT=1703 bp (for sanger sequencing) KI=2420 bp Pbk KO TGGAGCAAAATTTGAGTGTTGG ACCACATACTGCCACAAAGT WT=248 bp aUpper case letters anneal to the template, lower case letters provide overlaps for assembly. ..

    Article Title: Engineered Membrane Vesicle Production via oprF or oprI Deletion Has Distinct Phenotypic Effects in Pseudomonas putida
    Article Snippet: This study pTM007 pBTL-2-based plasmid for the expression of mNeonGreen The expression cassette contained the Plac, RBS (TIR: 193180.16), and mNeonGreen (originally from Addgene Plasmid #182388). .. This study pTM008 pBTL-2-based plasmid for the expression of mNeonGreen-vesicle nucleating peptide (vNP) The expression cassette contained Plac, RBS (same as above TIR: 305719.82), VNp fused to mNeonGreen (originally from Addgene Plasmid #182388). ..

    Article Title: Microinjection, gene knockdown, and CRISPR-mediated gene knock-in in the hard coral, Astrangia poculata.
    Article Snippet: .. The oligo sequences were as follows (Apoc homology sequences, sgRNA mutations, [linker], mNeon priming region): Apoc_Mcol3_Homology_F: 5′GCG TCT CGT CCT GCC CGA CCC AGT GCT GCT CCGG GAGGAAA[GCC GCA ]ATG GTG AGC AAG GGC 3′ Apoc_Mcol3_Homology_R: 5′TAA TTT CTA AAT CTC GTG CTA ATG TCG ACG CATCA AGTGC TCGTGGCTTA CTT GTA CAG CTC GTC 3′ PCR amplification of the repair template was performed using 50 ng of plasmid containing mNeonGreen (Addgene 125134) as template in a touchdown PCR reaction (annealing temperature decreased 1 °C from 65 °C to 50 °C for the first 15 cycles followed by 20 cycles with an annealing temperature of 50 °C; extension time was 30 s). .. Afterwards, the template was digested by addition of DpnI enzyme (NEB R0176S) and incubation at 37 °C for 2 h. The repair template was then purified using a QiaQuick PCR purification kit (Qiagen 28704 prior to injection and quality assessed using agarose gel electrophoresis, to ensure size, and Nanodrop, to assess purity and concentration.

    Expressing:

    Article Title: Engineered Membrane Vesicle Production via oprF or oprI Deletion Has Distinct Phenotypic Effects in Pseudomonas putida
    Article Snippet: .. This study Addgene Plasmid #182390 pRSFDuet-1 based plasmid containing VNpmNeonGreen_OmpAmCherry pRSFDuet-1_VNp-mNeonGreen_OmpAmCherry was a gift from Dan Mulvihill (Addgene plasmid # 182390 ; http://n2t.net/addgene:182390 ; RRID:Addgene_182390) (13) Addgene Plasmid #182388 pRSFDuet-1 based plasmid containing VNp6mNeonGreen pRSFDuet-1_VNp6-mNeonGreen was a gift from Dan Mulvihill (Addgene plasmid # 182388 ; http://n2t.net/addgene:182388 ; RRID:Addgene_182388) (13) pRW075 pBTL-2-based plasmid for the expression of spycatcher003The expression cassette included Plac, ribosome binding site [RBS; translation initiation rate (TIR) = 10277.53], ompAEC, linker, spycatcher003, RBS (TIR: This study 10 ompAEC:spytag003mNeonGreen 193180.16), mNeonGreen (originally from Addgene Plasmid #182388), linker, spytag003, and soxR terminator. .. The ompAEC, linkers, spycatcher003, and spytag003 were codon optimized using Integrated DNA Technologies Codon Optimization Tool.

    Article Title: Engineered Membrane Vesicle Production via oprF or oprI Deletion Has Distinct Phenotypic Effects in Pseudomonas putida
    Article Snippet: Plasmid was sequenced verified by Oxford Nanopore Sequencing. .. This study pTM007 pBTL-2-based plasmid for the expression of mNeonGreen The expression cassette contained the Plac, RBS (TIR: 193180.16), and mNeonGreen (originally from Addgene Plasmid #182388). ..

    Article Title: Engineered Membrane Vesicle Production via oprF or oprI Deletion Has Distinct Phenotypic Effects in Pseudomonas putida
    Article Snippet: This study pTM007 pBTL-2-based plasmid for the expression of mNeonGreen The expression cassette contained the Plac, RBS (TIR: 193180.16), and mNeonGreen (originally from Addgene Plasmid #182388). .. This study pTM008 pBTL-2-based plasmid for the expression of mNeonGreen-vesicle nucleating peptide (vNP) The expression cassette contained Plac, RBS (same as above TIR: 305719.82), VNp fused to mNeonGreen (originally from Addgene Plasmid #182388). ..

    Binding Assay:

    Article Title: Engineered Membrane Vesicle Production via oprF or oprI Deletion Has Distinct Phenotypic Effects in Pseudomonas putida
    Article Snippet: .. This study Addgene Plasmid #182390 pRSFDuet-1 based plasmid containing VNpmNeonGreen_OmpAmCherry pRSFDuet-1_VNp-mNeonGreen_OmpAmCherry was a gift from Dan Mulvihill (Addgene plasmid # 182390 ; http://n2t.net/addgene:182390 ; RRID:Addgene_182390) (13) Addgene Plasmid #182388 pRSFDuet-1 based plasmid containing VNp6mNeonGreen pRSFDuet-1_VNp6-mNeonGreen was a gift from Dan Mulvihill (Addgene plasmid # 182388 ; http://n2t.net/addgene:182388 ; RRID:Addgene_182388) (13) pRW075 pBTL-2-based plasmid for the expression of spycatcher003The expression cassette included Plac, ribosome binding site [RBS; translation initiation rate (TIR) = 10277.53], ompAEC, linker, spycatcher003, RBS (TIR: This study 10 ompAEC:spytag003mNeonGreen 193180.16), mNeonGreen (originally from Addgene Plasmid #182388), linker, spytag003, and soxR terminator. .. The ompAEC, linkers, spycatcher003, and spytag003 were codon optimized using Integrated DNA Technologies Codon Optimization Tool.

    Polymerase Chain Reaction:

    Article Title: Microinjection, gene knockdown, and CRISPR-mediated gene knock-in in the hard coral, Astrangia poculata
    Article Snippet: .. The oligo sequences were as follows ( Apoc homology sequences, sgRNA mutations , [linker], mNeon priming region ): Apoc_Mcol3_Homology_F: 5′GCGTCTCGTCCTGCCCGACCCAGTGCTGCTCCGG G AG G AA A [GCCGCA] ATGGTGAGCAAGGGC 3′ Apoc_Mcol3_Homology_R: 5′TAATTTCTAAATCTCGTGCTAATGTCGACGCATCA AGTGC T C GT G GC TTACTTGTACAGCTCGTC 3′ PCR amplification of the repair template was performed using 50 ng of plasmid containing mNeonGreen (Addgene 125134) as template in a touchdown PCR reaction (annealing temperature decreased 1 °C from 65 °C to 50 °C for the first 15 cycles followed by 20 cycles with an annealing temperature of 50 °C; extension time was 30 s). .. Afterwards, the template was digested by addition of DpnI enzyme (NEB R0176S) and incubation at 37 °C for 2 h. The repair template was then purified using a QiaQuick PCR purification kit (Qiagen 28704 prior to injection and quality assessed using agarose gel electrophoresis, to ensure size, and Nanodrop, to assess purity and concentration.

    Article Title: Microinjection, gene knockdown, and CRISPR-mediated gene knock-in in the hard coral, Astrangia poculata.
    Article Snippet: .. The oligo sequences were as follows (Apoc homology sequences, sgRNA mutations, [linker], mNeon priming region): Apoc_Mcol3_Homology_F: 5′GCG TCT CGT CCT GCC CGA CCC AGT GCT GCT CCGG GAGGAAA[GCC GCA ]ATG GTG AGC AAG GGC 3′ Apoc_Mcol3_Homology_R: 5′TAA TTT CTA AAT CTC GTG CTA ATG TCG ACG CATCA AGTGC TCGTGGCTTA CTT GTA CAG CTC GTC 3′ PCR amplification of the repair template was performed using 50 ng of plasmid containing mNeonGreen (Addgene 125134) as template in a touchdown PCR reaction (annealing temperature decreased 1 °C from 65 °C to 50 °C for the first 15 cycles followed by 20 cycles with an annealing temperature of 50 °C; extension time was 30 s). .. Afterwards, the template was digested by addition of DpnI enzyme (NEB R0176S) and incubation at 37 °C for 2 h. The repair template was then purified using a QiaQuick PCR purification kit (Qiagen 28704 prior to injection and quality assessed using agarose gel electrophoresis, to ensure size, and Nanodrop, to assess purity and concentration.

    Amplification:

    Article Title: Microinjection, gene knockdown, and CRISPR-mediated gene knock-in in the hard coral, Astrangia poculata
    Article Snippet: .. The oligo sequences were as follows ( Apoc homology sequences, sgRNA mutations , [linker], mNeon priming region ): Apoc_Mcol3_Homology_F: 5′GCGTCTCGTCCTGCCCGACCCAGTGCTGCTCCGG G AG G AA A [GCCGCA] ATGGTGAGCAAGGGC 3′ Apoc_Mcol3_Homology_R: 5′TAATTTCTAAATCTCGTGCTAATGTCGACGCATCA AGTGC T C GT G GC TTACTTGTACAGCTCGTC 3′ PCR amplification of the repair template was performed using 50 ng of plasmid containing mNeonGreen (Addgene 125134) as template in a touchdown PCR reaction (annealing temperature decreased 1 °C from 65 °C to 50 °C for the first 15 cycles followed by 20 cycles with an annealing temperature of 50 °C; extension time was 30 s). .. Afterwards, the template was digested by addition of DpnI enzyme (NEB R0176S) and incubation at 37 °C for 2 h. The repair template was then purified using a QiaQuick PCR purification kit (Qiagen 28704 prior to injection and quality assessed using agarose gel electrophoresis, to ensure size, and Nanodrop, to assess purity and concentration.

    Article Title: Microinjection, gene knockdown, and CRISPR-mediated gene knock-in in the hard coral, Astrangia poculata.
    Article Snippet: .. The oligo sequences were as follows (Apoc homology sequences, sgRNA mutations, [linker], mNeon priming region): Apoc_Mcol3_Homology_F: 5′GCG TCT CGT CCT GCC CGA CCC AGT GCT GCT CCGG GAGGAAA[GCC GCA ]ATG GTG AGC AAG GGC 3′ Apoc_Mcol3_Homology_R: 5′TAA TTT CTA AAT CTC GTG CTA ATG TCG ACG CATCA AGTGC TCGTGGCTTA CTT GTA CAG CTC GTC 3′ PCR amplification of the repair template was performed using 50 ng of plasmid containing mNeonGreen (Addgene 125134) as template in a touchdown PCR reaction (annealing temperature decreased 1 °C from 65 °C to 50 °C for the first 15 cycles followed by 20 cycles with an annealing temperature of 50 °C; extension time was 30 s). .. Afterwards, the template was digested by addition of DpnI enzyme (NEB R0176S) and incubation at 37 °C for 2 h. The repair template was then purified using a QiaQuick PCR purification kit (Qiagen 28704 prior to injection and quality assessed using agarose gel electrophoresis, to ensure size, and Nanodrop, to assess purity and concentration.

    Touchdown PCR:

    Article Title: Microinjection, gene knockdown, and CRISPR-mediated gene knock-in in the hard coral, Astrangia poculata
    Article Snippet: .. The oligo sequences were as follows ( Apoc homology sequences, sgRNA mutations , [linker], mNeon priming region ): Apoc_Mcol3_Homology_F: 5′GCGTCTCGTCCTGCCCGACCCAGTGCTGCTCCGG G AG G AA A [GCCGCA] ATGGTGAGCAAGGGC 3′ Apoc_Mcol3_Homology_R: 5′TAATTTCTAAATCTCGTGCTAATGTCGACGCATCA AGTGC T C GT G GC TTACTTGTACAGCTCGTC 3′ PCR amplification of the repair template was performed using 50 ng of plasmid containing mNeonGreen (Addgene 125134) as template in a touchdown PCR reaction (annealing temperature decreased 1 °C from 65 °C to 50 °C for the first 15 cycles followed by 20 cycles with an annealing temperature of 50 °C; extension time was 30 s). .. Afterwards, the template was digested by addition of DpnI enzyme (NEB R0176S) and incubation at 37 °C for 2 h. The repair template was then purified using a QiaQuick PCR purification kit (Qiagen 28704 prior to injection and quality assessed using agarose gel electrophoresis, to ensure size, and Nanodrop, to assess purity and concentration.

    Article Title: Microinjection, gene knockdown, and CRISPR-mediated gene knock-in in the hard coral, Astrangia poculata.
    Article Snippet: .. The oligo sequences were as follows (Apoc homology sequences, sgRNA mutations, [linker], mNeon priming region): Apoc_Mcol3_Homology_F: 5′GCG TCT CGT CCT GCC CGA CCC AGT GCT GCT CCGG GAGGAAA[GCC GCA ]ATG GTG AGC AAG GGC 3′ Apoc_Mcol3_Homology_R: 5′TAA TTT CTA AAT CTC GTG CTA ATG TCG ACG CATCA AGTGC TCGTGGCTTA CTT GTA CAG CTC GTC 3′ PCR amplification of the repair template was performed using 50 ng of plasmid containing mNeonGreen (Addgene 125134) as template in a touchdown PCR reaction (annealing temperature decreased 1 °C from 65 °C to 50 °C for the first 15 cycles followed by 20 cycles with an annealing temperature of 50 °C; extension time was 30 s). .. Afterwards, the template was digested by addition of DpnI enzyme (NEB R0176S) and incubation at 37 °C for 2 h. The repair template was then purified using a QiaQuick PCR purification kit (Qiagen 28704 prior to injection and quality assessed using agarose gel electrophoresis, to ensure size, and Nanodrop, to assess purity and concentration.

    CRISPR:

    Article Title: PBK/TOPK mediates Ikaros, Aiolos and CTCF displacement from mitotic chromosomes and alters chromatin accessibility at selected C2H2-zinc finger protein binding sites
    Article Snippet: .. EBFP2 gene (3519 bp) atcctggttcctgttcttccccgagTAAGCTTGGGCCGCTCGAG gggataaggtgccatctttcccaggTTCCTGCCCGACCTTGGTAC Plasmid gifted by Stefan Stricker129 Ikzf1 left homology arm (820 bp to final codon) CCTGGGAAAGATGGCACC GCTCAGGTGGTAACGATG Genomic DNA Spacer (underlined) plus mNeonGreen (720 bp) gggggagcatcgttaccacctgagcggaggtggttctGTGAGCAAGGGCGAGGAG gtgcttcagtggggcctggctgggtTTACTTGTACAGCTCGTCCATG 3xnls-mNeonGreen (Addgene #98875), gift from Dorus Gadella130 Ikzf1 right homology arm (880 bp downstream) ACCCAGCCAGGCCCCACTG CTCGGGGAAGAACAGGAACCAGG Genomic DNA Verification of CRISPR/Cas9 engineered cells Purpose Oligo sequences Expected sizes Ikzf1 WT versus mNeonGreen KI (1) GGCTTTCGGGATCCCTTTGA TCCACTCCCAACATTGTCCG WT=197 bp KI=914 bp (for sanger sequencing) Ikzf1 WT versus mNeonGreen KI (2) CCTGGGAAAGATGGCACC CTCGGGGAAGAACAGGAACCAGG WT=1703 bp (for sanger sequencing) KI=2420 bp Pbk KO TGGAGCAAAATTTGAGTGTTGG ACCACATACTGCCACAAAGT WT=248 bp aUpper case letters anneal to the template, lower case letters provide overlaps for assembly. ..

    Sequencing:

    Article Title: PBK/TOPK mediates Ikaros, Aiolos and CTCF displacement from mitotic chromosomes and alters chromatin accessibility at selected C2H2-zinc finger protein binding sites
    Article Snippet: .. EBFP2 gene (3519 bp) atcctggttcctgttcttccccgagTAAGCTTGGGCCGCTCGAG gggataaggtgccatctttcccaggTTCCTGCCCGACCTTGGTAC Plasmid gifted by Stefan Stricker129 Ikzf1 left homology arm (820 bp to final codon) CCTGGGAAAGATGGCACC GCTCAGGTGGTAACGATG Genomic DNA Spacer (underlined) plus mNeonGreen (720 bp) gggggagcatcgttaccacctgagcggaggtggttctGTGAGCAAGGGCGAGGAG gtgcttcagtggggcctggctgggtTTACTTGTACAGCTCGTCCATG 3xnls-mNeonGreen (Addgene #98875), gift from Dorus Gadella130 Ikzf1 right homology arm (880 bp downstream) ACCCAGCCAGGCCCCACTG CTCGGGGAAGAACAGGAACCAGG Genomic DNA Verification of CRISPR/Cas9 engineered cells Purpose Oligo sequences Expected sizes Ikzf1 WT versus mNeonGreen KI (1) GGCTTTCGGGATCCCTTTGA TCCACTCCCAACATTGTCCG WT=197 bp KI=914 bp (for sanger sequencing) Ikzf1 WT versus mNeonGreen KI (2) CCTGGGAAAGATGGCACC CTCGGGGAAGAACAGGAACCAGG WT=1703 bp (for sanger sequencing) KI=2420 bp Pbk KO TGGAGCAAAATTTGAGTGTTGG ACCACATACTGCCACAAAGT WT=248 bp aUpper case letters anneal to the template, lower case letters provide overlaps for assembly. ..

    Transduction:

    Article Title: Multi-immersion Oblique Plane Microscope (miOPM): A reconfigurable platform for high-resolution Light-Sheet Fluorescence Microscopy
    Article Snippet: .. hTERT RPE-1 cells (ATCC CRL-4000) were lentivirally transduced with a modified pLVX-shRNA1 vector in which mNeonGreen–EB3 was placed downstream of a truncated CMV promoter (Addgene #110718). .. Cells were maintained in ATCC-formulated DMEM/F12 supplemented with 10% FBS and 1% antibiotic–antimycotic (anti-anti) and were routinely screened for mycoplasma.

    Modification:

    Article Title: Multi-immersion Oblique Plane Microscope (miOPM): A reconfigurable platform for high-resolution Light-Sheet Fluorescence Microscopy
    Article Snippet: .. hTERT RPE-1 cells (ATCC CRL-4000) were lentivirally transduced with a modified pLVX-shRNA1 vector in which mNeonGreen–EB3 was placed downstream of a truncated CMV promoter (Addgene #110718). .. Cells were maintained in ATCC-formulated DMEM/F12 supplemented with 10% FBS and 1% antibiotic–antimycotic (anti-anti) and were routinely screened for mycoplasma.

    Countercurrent Chromatography:

    Article Title: Microinjection, gene knockdown, and CRISPR-mediated gene knock-in in the hard coral, Astrangia poculata.
    Article Snippet: .. The oligo sequences were as follows (Apoc homology sequences, sgRNA mutations, [linker], mNeon priming region): Apoc_Mcol3_Homology_F: 5′GCG TCT CGT CCT GCC CGA CCC AGT GCT GCT CCGG GAGGAAA[GCC GCA ]ATG GTG AGC AAG GGC 3′ Apoc_Mcol3_Homology_R: 5′TAA TTT CTA AAT CTC GTG CTA ATG TCG ACG CATCA AGTGC TCGTGGCTTA CTT GTA CAG CTC GTC 3′ PCR amplification of the repair template was performed using 50 ng of plasmid containing mNeonGreen (Addgene 125134) as template in a touchdown PCR reaction (annealing temperature decreased 1 °C from 65 °C to 50 °C for the first 15 cycles followed by 20 cycles with an annealing temperature of 50 °C; extension time was 30 s). .. Afterwards, the template was digested by addition of DpnI enzyme (NEB R0176S) and incubation at 37 °C for 2 h. The repair template was then purified using a QiaQuick PCR purification kit (Qiagen 28704 prior to injection and quality assessed using agarose gel electrophoresis, to ensure size, and Nanodrop, to assess purity and concentration.



    Similar Products

    cell lines dld 1 cen select mneongreen  (ATCC)
    97
    ATCC cell lines dld 1 cen select mneongreen
    Cell Lines Dld 1 Cen Select Mneongreen, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mneongreen/HeLa+S3/pm42161273-198-78-111
    Average 97 stars, based on 1 article reviews
    cell lines dld 1 cen select mneongreen - by Bioz Stars, 2026-09
    97/100 stars
    		  Buy from Supplier
    h2b mneongreen p10  (Twist Bioscience)
    86
    Twist Bioscience h2b mneongreen p10
    H2b Mneongreen P10, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mneongreen/h2b+hibit/bio_rxiv__64898__2026__03__07__709930-256-33-38
    Average 86 stars, based on 1 article reviews
    h2b mneongreen p10 - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    aav syn sirt3 mneongreen  (Obio Technology Corp Ltd)
    86
    Obio Technology Corp Ltd aav syn sirt3 mneongreen
    Aav Syn Sirt3 Mneongreen, supplied by Obio Technology Corp Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mneongreen/aav+h11264+jgcamp7s+pgp+syn+wpre/pmc13211829-64-0-12
    Average 86 stars, based on 1 article reviews
    aav syn sirt3 mneongreen - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    zyxin  (ATCC)
    95
    ATCC zyxin
    Zyxin, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mneongreen/PtK2/pm42020745-557-7-12
    Average 95 stars, based on 1 article reviews
    zyxin - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier
    paav cag mneongreen 565  (Addgene inc)
    93
    Addgene inc paav cag mneongreen 565
    Paav Cag Mneongreen 565, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mneongreen/pAAV-CAG-mNeonGreen+(Plasmid+%2399134)/10__1016_slash_j__isci__2026__115554-284-21-23
    Average 93 stars, based on 1 article reviews
    paav cag mneongreen 565 - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    plasmid encoding caspase 9 bret sensor  (Addgene inc)
    91
    Addgene inc plasmid encoding caspase 9 bret sensor
    Plasmid Encoding Caspase 9 Bret Sensor, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mneongreen/pcDNA3%2E1-mNeonGreen-LEHD-NanoLuc+(Plasmid+%2398289)/pm41916304-311-1-9
    Average 91 stars, based on 1 article reviews
    plasmid encoding caspase 9 bret sensor - by Bioz Stars, 2026-09
    91/100 stars
    		  Buy from Supplier
    neongreen vector  (Addgene inc)
    93
    Addgene inc neongreen vector
    Neongreen Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mneongreen/LifeAct-mNeonGreen+(Plasmid+%2398877)/pm41861019-385-32-34
    Average 93 stars, based on 1 article reviews
    neongreen vector - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    neongreen  (Cell Signaling Technology Inc)
    94
    Cell Signaling Technology Inc neongreen
    Identifying targets for combination therapies with oncolytic vaccinia (A) Schematic summarizing the high-throughput drug screening strategy. (B) Representative images of ID8 Trp53 −/− cells infected with ΔVFTK-NG virus and treated with the indicated compounds belonging to the four categories. <t>NeonGreen</t> expression (green) indicates infected cells, and DAPI was used to stain nuclei (blue). Cells were imaged using Opera Phenix Plus with 10× air objective. Scale bars, 200 μm. (C) Graphical illustration of compound allocation in the four categories. (D) Representative graphs from the secondary validation screen of selected primary screen hits at 1 μM (omipalisib, erlotinib, and vinorelbine). The model represents an ideal compound, and DMSO is the negative control. The purple dashed line represents the time at which ΔVFTK-NG virus (MOI 0.5) was added (16 h after cell seeding). Statistical analysis was done by comparing uninfected against infected cell confluency at 20, 60, and 90 h after cell seeding using Student’s t test. Error bars represent standard deviation (SD). (E) List of hit compounds after the secondary validation screen.
    Neongreen, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mneongreen/mNeonGreen+Tag+Rabbit+mAb/pmc13006439-275-62-64
    Average 94 stars, based on 1 article reviews
    neongreen - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    immunohistochemistry ihc  (Cell Signaling Technology Inc)
    94
    Cell Signaling Technology Inc immunohistochemistry ihc
    Identifying targets for combination therapies with oncolytic vaccinia (A) Schematic summarizing the high-throughput drug screening strategy. (B) Representative images of ID8 Trp53 −/− cells infected with ΔVFTK-NG virus and treated with the indicated compounds belonging to the four categories. <t>NeonGreen</t> expression (green) indicates infected cells, and DAPI was used to stain nuclei (blue). Cells were imaged using Opera Phenix Plus with 10× air objective. Scale bars, 200 μm. (C) Graphical illustration of compound allocation in the four categories. (D) Representative graphs from the secondary validation screen of selected primary screen hits at 1 μM (omipalisib, erlotinib, and vinorelbine). The model represents an ideal compound, and DMSO is the negative control. The purple dashed line represents the time at which ΔVFTK-NG virus (MOI 0.5) was added (16 h after cell seeding). Statistical analysis was done by comparing uninfected against infected cell confluency at 20, 60, and 90 h after cell seeding using Student’s t test. Error bars represent standard deviation (SD). (E) List of hit compounds after the secondary validation screen.
    Immunohistochemistry Ihc, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mneongreen/mNeonGreen+Tag+Rabbit+mAb/pmc13006439-316-1-9
    Average 94 stars, based on 1 article reviews
    immunohistochemistry ihc - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier

    Image Search Results


    Identifying targets for combination therapies with oncolytic vaccinia (A) Schematic summarizing the high-throughput drug screening strategy. (B) Representative images of ID8 Trp53 −/− cells infected with ΔVFTK-NG virus and treated with the indicated compounds belonging to the four categories. NeonGreen expression (green) indicates infected cells, and DAPI was used to stain nuclei (blue). Cells were imaged using Opera Phenix Plus with 10× air objective. Scale bars, 200 μm. (C) Graphical illustration of compound allocation in the four categories. (D) Representative graphs from the secondary validation screen of selected primary screen hits at 1 μM (omipalisib, erlotinib, and vinorelbine). The model represents an ideal compound, and DMSO is the negative control. The purple dashed line represents the time at which ΔVFTK-NG virus (MOI 0.5) was added (16 h after cell seeding). Statistical analysis was done by comparing uninfected against infected cell confluency at 20, 60, and 90 h after cell seeding using Student’s t test. Error bars represent standard deviation (SD). (E) List of hit compounds after the secondary validation screen.

    Journal: Molecular Therapy Oncology

    Article Title: Vinorelbine enhances the efficacy of oncolytic vaccinia virus in a preclinical model of ovarian high-grade serous carcinoma

    doi: 10.1016/j.omton.2025.201105

    Figure Lengend Snippet: Identifying targets for combination therapies with oncolytic vaccinia (A) Schematic summarizing the high-throughput drug screening strategy. (B) Representative images of ID8 Trp53 −/− cells infected with ΔVFTK-NG virus and treated with the indicated compounds belonging to the four categories. NeonGreen expression (green) indicates infected cells, and DAPI was used to stain nuclei (blue). Cells were imaged using Opera Phenix Plus with 10× air objective. Scale bars, 200 μm. (C) Graphical illustration of compound allocation in the four categories. (D) Representative graphs from the secondary validation screen of selected primary screen hits at 1 μM (omipalisib, erlotinib, and vinorelbine). The model represents an ideal compound, and DMSO is the negative control. The purple dashed line represents the time at which ΔVFTK-NG virus (MOI 0.5) was added (16 h after cell seeding). Statistical analysis was done by comparing uninfected against infected cell confluency at 20, 60, and 90 h after cell seeding using Student’s t test. Error bars represent standard deviation (SD). (E) List of hit compounds after the secondary validation screen.

    Article Snippet: Primary antibodies used were F12 (1:4,000, ), F13 (1:6,000, ), H5 (1:10,000, ), GRB2 (1:1,000, Santa Cruz, Dallas, Texas, #sc-255), Vinculin (1:10,000, Sigma-Aldrich, #V9264), GAPDH (1:1,000, Santa Cruz, #sc-32233), PARP (1:1,000, Cell Signaling, Danvers, Massachusetts, #9542), cleaved caspase-8 (1:1,000, Cell Signaling, #8592), cleaved caspase-3 (1:1,000, Cell Signaling, #9664), LC3-B (1:1,000, Abcam [#ab48394], Cambridge, UK), p62/SQSTM1 (1:1,000, Novus Biologicals, Centennial, Colorado, #NBP1-42822), and NeonGreen (1:1,000, Cell Signaling, #41236).

    Techniques: High Throughput Screening Assay, Drug discovery, Infection, Virus, Expressing, Staining, Biomarker Discovery, Negative Control, Standard Deviation

    Assessing the efficacy of ΔVFTK-NG-GM-CSF in vivo (A) Schematic representation of the experimental design of the distribution study. Mice were injected i.p. with ID8 Trp53 −/− cells on day 0 and received their i.p. injection on day 28, and the combination groups received their second component (vinorelbine or virus) on day 29. Heat-inactivated (HI) virus (ΔVFTK-NG-GM-CSFi) is the negative control. (B) Quantification of viral DNA in omental tumor, liver, and spleen measured by qPCR and expressed relative to viral DNA levels of the liver sample in the HI virus group. Error bars represent mean ± SD. (C) Representative immunohistochemical images of the distribution of cleaved caspase-3 and NeonGreen in omental tumor, liver, and spleen harvested from a mouse in group 4. The graph shows the quantification of NeonGreen-positive cells in omental tumors. (D) Representative immunohistochemical images of the distribution of cleaved caspase-3 and NeonGreen in omental tumors from mice in groups 1, 3, and 4. The graph shows the quantification of cleaved caspase-3-positive cells in omental tumors. (E) Schematic representation of the experimental design of the vaccinia-vinorelbine combination study. Mice were injected with ID8 Trp53 −/− cells on day 0 and started receiving their i.p. treatment injections on day 21. Mice allocated to single-treatment groups received their inoculations on days 21, 28, and 35, and those allocated to the combination groups received vinorelbine and ΔVFTK-NG-GM-CSF 24 h apart. Heat-inactivated (HI) ΔVFTK-NG-GM-CSFi virus was the negative control. (F) Kaplan-Meier survival curve showing survival data for each group analyzed by log rank test. One mouse belonging to group 2 was excluded from the analysis, as after i.p. injection of ID8 Trp53 −/− cells omental tumor failed to form. The analysis is from the combination of two survival experiments following the same protocols.

    Journal: Molecular Therapy Oncology

    Article Title: Vinorelbine enhances the efficacy of oncolytic vaccinia virus in a preclinical model of ovarian high-grade serous carcinoma

    doi: 10.1016/j.omton.2025.201105

    Figure Lengend Snippet: Assessing the efficacy of ΔVFTK-NG-GM-CSF in vivo (A) Schematic representation of the experimental design of the distribution study. Mice were injected i.p. with ID8 Trp53 −/− cells on day 0 and received their i.p. injection on day 28, and the combination groups received their second component (vinorelbine or virus) on day 29. Heat-inactivated (HI) virus (ΔVFTK-NG-GM-CSFi) is the negative control. (B) Quantification of viral DNA in omental tumor, liver, and spleen measured by qPCR and expressed relative to viral DNA levels of the liver sample in the HI virus group. Error bars represent mean ± SD. (C) Representative immunohistochemical images of the distribution of cleaved caspase-3 and NeonGreen in omental tumor, liver, and spleen harvested from a mouse in group 4. The graph shows the quantification of NeonGreen-positive cells in omental tumors. (D) Representative immunohistochemical images of the distribution of cleaved caspase-3 and NeonGreen in omental tumors from mice in groups 1, 3, and 4. The graph shows the quantification of cleaved caspase-3-positive cells in omental tumors. (E) Schematic representation of the experimental design of the vaccinia-vinorelbine combination study. Mice were injected with ID8 Trp53 −/− cells on day 0 and started receiving their i.p. treatment injections on day 21. Mice allocated to single-treatment groups received their inoculations on days 21, 28, and 35, and those allocated to the combination groups received vinorelbine and ΔVFTK-NG-GM-CSF 24 h apart. Heat-inactivated (HI) ΔVFTK-NG-GM-CSFi virus was the negative control. (F) Kaplan-Meier survival curve showing survival data for each group analyzed by log rank test. One mouse belonging to group 2 was excluded from the analysis, as after i.p. injection of ID8 Trp53 −/− cells omental tumor failed to form. The analysis is from the combination of two survival experiments following the same protocols.

    Article Snippet: Primary antibodies used were F12 (1:4,000, ), F13 (1:6,000, ), H5 (1:10,000, ), GRB2 (1:1,000, Santa Cruz, Dallas, Texas, #sc-255), Vinculin (1:10,000, Sigma-Aldrich, #V9264), GAPDH (1:1,000, Santa Cruz, #sc-32233), PARP (1:1,000, Cell Signaling, Danvers, Massachusetts, #9542), cleaved caspase-8 (1:1,000, Cell Signaling, #8592), cleaved caspase-3 (1:1,000, Cell Signaling, #9664), LC3-B (1:1,000, Abcam [#ab48394], Cambridge, UK), p62/SQSTM1 (1:1,000, Novus Biologicals, Centennial, Colorado, #NBP1-42822), and NeonGreen (1:1,000, Cell Signaling, #41236).

    Techniques: In Vivo, Injection, Virus, Negative Control, Immunohistochemical staining